Public Pricelist
Sort By: Newest Arrivals
  • Vaccine research
  • Beads
  • Elisa Assay Kit
  • Dyes
  • Strains
  • Molecular Biology
  • Monoclonal Antibodies
  • Cell lines and Normal Cells
  • Serum for Cell Culture and IgG
  • Lentivectors
  • Caspases
  • FFPE Formalin-Fixed Paraffin-Embedded
  • Goat Polyclonal
  • Mouse Monoclonal
  • Rabbit Polyclonals
  • Exosomes
  • E. coli Recombinant
  • E. coli Recombinant
  • Horseradish peroxidase (HRP)
  • Tumor
  • Plasmids
  • Assay test kits
  • NATtrol Controls
  • RNA research
  • Particles
  • Peptide
  • Tauns
  • biolipidure
General Sphingosine (SPH) ELISA Test - 96-wells plate
613.00 € 613.0 EUR
General Selenium Assay Test - 100 Assays
900.00 € 900.0 EUR
General Phosphoenolpyruvate Carboxylase Assay Test 100 Assays
701.30 € 701.3000000000001 EUR
General PTD(Pentosidine) ELISA Test - 96T
480.00 € 480.0 EUR
General Na+/K+ ATPase Assay Test - 100
564.00 € 564.0 EUR
General Melatonin (MT) ELISA Test - 48T
731.00 € 731.0 EUR
General Hydroxyproline (HYP) ELISA Test - 96 wells plate
564.00 € 564.0 EUR
General GFP (Green Fluorescent Protein) ELISA Test - 96 wells plate
582.00 € 582.0 EUR
General Estradiol, E2 ELISA Test, 96 test
479.00 € 479.0 EUR
General Docosahexaenoic Acid (DHA) ELISA Test - 96 wells plate
794.00 € 794.0 EUR
General Docosahexaenoic Acid (DHA) ELISA Test - 48 wells plate
641.00 € 641.0 EUR
General Cortisol (COR) ELISA Test - 96 wells plate
450.00 € 450.0 EUR
General Chondroitin sulfate,CS elisa Test - 96T
638.00 € 638.0 EUR
General Chitinase Assay Test - 100 Assays
722.00 € 722.0 EUR
General CML/ N(6)-Carboxymethyllysine ELISA Test, 96 tests
558.00 € 558.0 EUR
General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Test - 48 Tests
655.00 € 655.0 EUR
GeneQ thermal cycler, 24x0.2ml
2,527.00 € 2527.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Test - 25 Preps
140.00 € 140.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Test - 100 Preps
375.00 € 375.0 EUR
Gene Synthesis - Per bp - 5'UTR sequence from Custom gene: 5'-CTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATT TCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGA AATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATAT GTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAA CAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACT CTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCAC A -3' 285bp + 60 bp cloning sites = 345bp Not a deliverable. Use for C452.
300.00 € 300.0 EUR
GenJet In Vitro siRNA Transfection Reagent (Ver. II) - 1 mL
331.00 € 331.0 EUR
Gemcitabine, Free Base, >99%, 500 mG.
284.00 € 284.0 EUR
Gem21 NeuroPlex Supplement without Vitamin A, 10 ml
359.00 € 359.0 EUR
Gellan Gum - 100 g
36.99 € 36.99 EUR
Gellan Gum - 1 kg
114.99 € 114.99000000000001 EUR
Gelatin-Coated Microscope Slides (75X50 mm) - 100 slides/box
652.00 € 652.0 EUR
Gelatin-Coated Microscope Slides (75X25 Mm) - 100 slides/box
552.00 € 552.0 EUR
Gelatin from porcine skin, gel strength 300, Type A - 100 g
120.00 € 120.0 EUR
GelRed® Prestain Plus 6X DNA Loading Dye - 1 mL
146.28 € 146.28 EUR
GelRed® Nucleic Acid Gel Stain trail size - 0.1 ml
164.00 € 164.0 EUR
GelRed Nucleic Acid Stain 10,000X in water - 0.5 ml
300.00 € 300.0 EUR
GelRed Nucleic Acid Gel Stain, 10,000 x in water, 10 ml
2,772.00 € 2772.0 EUR
GelNest Matrix, low growth factor, without Phenol Red
1.00 € 1.0 EUR
GelGreen® Nucleic Acid Stain, 10,000X in water - 0.1 ML
222.40 € 222.4 EUR
GelGreen® Nucleic Acid Gel Stain, 10000X in water, 0.5 ml
277.00 € 277.0 EUR
GelGreen® Nucleic Acid Gel Stain - 10 mL, 10,000X in water
2,640.00 € 2640.0 EUR
GelGreen® Nucleic Acid Gel Stain - 10 mL, 10,000X in water
2,400.00 € 2400.0 EUR
GelGreen Nucleic Acid Gel Stain, 10,000X in DMSO - 0.5ML
275.00 € 275.0 EUR
Gel-Bright Laser Diode Gel Illuminator
2,480.00 € 2480.0 EUR
Gel Drying Film
222.50 € 222.5 EUR
Gamma-ECS | Gamma glutamylcysteine synthase
710.00 € 710.0 EUR
Gamma-Aminobutyric Acid (gABA) ELISA Test - 96 tests
1,050.00 € 1050.0 EUR
Galanthus nivalis Lectin (GNL/GNA) Separopore® 4B - 50 mL
4,263.00 € 4263.0 EUR
GZMK E. coli Rec. protein :: Granzyme K E. coli Rec. Protein, 0.1 mG.
655.00 € 655.0 EUR
GW2580, Free Base, >99% - 10g
2,703.37 € 2703.37 EUR
GVB++ (with Ca and mG.) - 1L
636.00 € 636.0 EUR
GV3101 Electrocompetent Agrobacterium - 6x50µl
691.00 € 691.0 EUR
GV3101 ElectroCompetent Agrobacterium - 6x 50 µl
726.00 € 726.0 EUR
GV3101 Chemically Competent Cell - 10 tubes (100μL/tube)
916.00 € 916.0 EUR
GV3101 Chemically Competent Agrobacterium - 6x50ul
577.00 € 577.0 EUR
GV3101 Chemically Competent Agrobacterium - 18x50ul
980.00 € 980.0 EUR
GV3101 Chemically Competent Agrobacterium - 10x50ul
746.00 € 746.0 EUR
GV3101 AGROBACTERIUM STRAIN
530.00 € 530.0 EUR
GV3101 (pSoup-p19) ElectroCompetent Agrobacterium - 6x50µl
779.00 € 779.0 EUR
GV3101 (pSoup-p19) ElectroCompetent Agrobacterium
694.00 € 694.0 EUR
GV3101 (pSoup-p19) Chemically Competent Cells - 10 tubes (100μL/tube)
916.00 € 916.0 EUR
GV3101 (pSoup) ElectroCompetent Agrobacterium - 6x50ul
779.00 € 779.0 EUR
GV3101 (pSoup) Chemically Competent Cells - 10 tubes (100μL/tube)
995.00 € 995.0 EUR
GV2260 Agrobacterium tumefaciens Strains - 100ul
470.00 € 470.0 EUR
GV2260 Agrobacterium Strain - 100 ul
474.50 € 474.5 EUR
GUINEA PIG, WHOLE BLOOD, ALSEVERS, DONOR, GENDER UNSPECIFIED, 100 ML
1,276.00 € 1276.0 EUR
GT elisa Test :: Rat Glutathione ELISA Test-96-Strip-Wells
1,035.00 € 1035.0 EUR
GSTp active protein :: Glutathione S Transferase Pi (GSTp) Active Protein - 0.1 mG.
890.00 € 890.0 EUR
GSTm1 E. coli Rec. protein :: Glutathione S Transferase Mu 1 (GSTm1) E. coli Rec. Protein - 0.1 mG.
737.00 € 737.0 EUR
GSTA1 active protein - 0.1 mG.
627.00 € 627.0 EUR
GST assay Test :: Glutathione S-Transferase (GST) Assay Test - 96 tests
386.00 € 386.0 EUR
GSSG elisa Test :: Rat Oxidized Glutathione ELISA Test-96-Strip-Wells
1,035.00 € 1035.0 EUR
GSH elisa Test :: Rat Reduced glutathione ELISA Test-96-Strip-Wells
1,035.00 € 1035.0 EUR
GSDMD antibody - 200 ul
593.00 € 593.0 EUR
GS115 Yeast strain (Genotype: His4 , Mut+) - 100ul
361.00 € 361.0 EUR
GRM7003-25G Fast Blue B Salt
113.00 € 113.0 EUR
GPX4 elisa Test :: Human Glutathione Peroxidase 4 (GPX4) ELISA Test - 96-Strip-Wells
1,180.00 € 1180.0 EUR
GPX4 elisa Test :: Human Glutathione Peroxidase 4 (GPX4) ELISA Test - 48-Strip-Wells
950.00 € 950.0 EUR
GPR84 Antibody - 100 ul
452.00 € 452.0 EUR
GPR173 elisa Test :: Bovine G protein-coupled receptor 173 ELISA Test - 96-Strip-Wells
1,140.00 € 1140.0 EUR
GPC3 E. coli Rec. Monoclonal Antibody - 100ul
520.00 € 520.0 EUR
GP2059 Forskolin 10mG.
283.00 € 283.0 EUR
GOT1 active protein :: Aspartate Aminotransferase Active Protein - 25K Units
516.50 € 516.5 EUR
GOLGA6A Antibody 100ul
490.00 € 490.0 EUR
GNMT E. coli Rec. protein - 0.1mG.
360.00 € 360.0 EUR
GN Broth, Hajna - 100 Gms
412.00 € 412.0 EUR
GN Broth Medium 11, 500G
105.00 € 105.0 EUR
GMP E. coli Rec. Human Interleukin-4 (IL-4), 50 ug.
483.00 € 483.0 EUR
GMOScreen RT IPC CsVMV / CV127 / DP305423-1 Soy (LR) for ABI 7500 (Fast) - 96 rxn
1,359.00 € 1359.0 EUR
GMOScreen RT IPC (LR) 35S/NOS/FMV for ABI 7500 (Fast) 96 RT-PCR reactions, up to 44 samples per plate. Multiplex screeningof pFMV, p35s and tNOS in a single tube with internal positive control(IPC).
929.00 € 929.0 EUR
GMOScreen RT 35S/NOS/ABII IPC (LR) - 96 rxn
1,466.00 € 1466.0 EUR
GMOQuant IPC (LR) 35S Screen Corn - 2 x 48 rxns
1,201.00 € 1201.0 EUR
GMOQuant (LR) 35S Screen Soy - 2 x 48 rxns
1,201.00 € 1201.0 EUR
GLP1R-22H E. coli Rec. Human GLP1R Protein, Biotinylated-50ug.-100ug.
2,750.00 € 2750.0 EUR
GLP1R-22H E. coli Rec. Human GLP1R Protein, Biotinylated-50ug.
1,620.00 € 1620.0 EUR
GLP1R E. coli Rec. antibody 0.1mG.
564.40 € 564.4 EUR
GLP1R Antibody - 100ug.
575.00 € 575.0 EUR
GLI2 elisa Test :: Human GLI family zinc finger 2 ELISA Test - 96-Strip-Wells
1,248.19 € 1248.19 EUR
GLI1 elisa Test :: Human Gli ELISA Test - 96-Strip-Wells
1,250.00 € 1250.0 EUR
GLI1 elisa Test :: Human Gli ELISA Test - 96-Strip-Wells
1,250.00 € 1250.0 EUR
GLFRDA 102 GAA Genemer Control DNA Friedreich's At axia (FRDA); 500 ng
438.00 € 438.0 EUR
GIB DNA Extraction Refill Consumables refill Test for use with Genes in a Bottle Test (1662300EDU), contains lysis buffer and powdered protease + salt, for 36 students
161.20 € 161.20000000000002 EUR
GHRL elisa Test :: Horse Ghrelin (GHRL) ELISA Test 96T
840.00 € 840.0 EUR
GHRELIN, HUMAN/RAT (TOTAL) / DETECTION, 125 test
1,289.00 € 1289.0 EUR
GGT1 active protein :: gamma-Glutamyl Transferase Active Protein, 25K Units
1,575.00 € 1575.0 EUR
GFP/Green Fluorescent Protein ELISA Test PicoKine - 96 wells plate
672.00 € 672.0 EUR
GFP Reporter Stable Cell Line HEK293 - 1 vial
6,338.00 € 6338.0 EUR
GFP RFP Dual Reporter Stably Expressing HEK293 Cell Line (690) 1x106 cells / 1.0 ml
3,110.00 € 3110.0 EUR
GFP Expressing Human brain astrocytes - 1mL frozen vial 500,000 cells
1,775.00 € 1775.0 EUR
GFP Expressing Human Umbilical Vein Endothelial Cells,500,000+ Cells frozen
1,630.00 € 1630.0 EUR
GFP Expressing Human Umbilical Vein Endothelial Cells (GFP-HUVECs)
2,300.00 € 2300.0 EUR
GFP Expressing Human Brain Astrocytes - 500,000 Cells - Frozen
1,919.00 € 1919.0 EUR
GFAP elisa Test :: Sheep GFAP ELISA Test 96T
1,009.00 € 1009.0 EUR
GFAP (Chicken IgY) - 100 µL
559.00 € 559.0 EUR
GENLISA SARS-CoV-2 (Covid-19) Neutralizing Antibody ELISA
662.00 € 662.0 EUR
GENLISA Mouse Anti-SARS-CoV-2 (Covid-19) IgG Antibody to spike S1+S2 ECD protein Quantitative TITRATION ELISA - 96 wells
890.00 € 890.0 EUR
GENLISA Human cycloOxygenase-Receptor2 (COX-2R) ELISA, 96 tests
650.00 € 650.0 EUR
GENESpin - 50 samples
452.00 € 452.0 EUR
GELATIN-BASED COATING SOLUTION- READY TO USE,100 ml
575.00 € 575.0 EUR
GEL FILTRATION CAL Test HMW
927.00 € 927.0 EUR
GDF-8/Myostatin 10ug.
465.00 € 465.0 EUR
GD-IgA1 elisa Test :: Human Galactose-Deficient IgA1 Autoantibody (Anti-GD-IgA1) ELISA Test - 96-Strip-Wells
1,130.00 € 1130.0 EUR
GC-270 Camel Genomic DNA, 0.1 mG.
245.00 € 245.0 EUR
GC elisa Test :: Human Glucagon (GC) ELISA Test -96 Wells
564.40 € 564.4 EUR
GBS Positive Control - 0.5 mL
676.00 € 676.0 EUR
GBS Negative Control - 0.5 mL
676.00 € 676.0 EUR
GAST elisa Test :: Rat gastrin ELISA Test 96T
1,060.00 € 1060.0 EUR